RegulonDB RegulonDB 10.9: Gene Sequence
tsf gene sequence


Size: 852        A: 247  T: 180  G: 239  C: 186

Fasta

 

>tsf E. coli K12. Version NC_000913.3 GI:556503834
atggctgaaattaccgcatccctggtaaaagagctgcgtgagcgtactggcgcaggcatg
atggattgcaaaaaagcactgactgaagctaacggcgacatcgagctggcaatcgaaaac
atgcgtaagtccggtgctattaaagcagcgaaaaaagcaggcaacgttgctgctgacggc
gtgatcaaaaccaaaatcgacggcaactacggcatcattctggaagttaactgccagact
gacttcgttgcaaaagacgctggtttccaggcgttcgcagacaaagttctggacgcagct
gttgctggcaaaatcactgacgttgaagttctgaaagcacagttcgaagaagaacgtgtt
gcgctggtagcgaaaattggtgaaaacatcaacattcgccgcgttgctgcgctggaaggc
gacgttctgggttcttatcagcacggtgcgcgtatcggcgttctggttgctgctaaaggc
gctgacgaagagctggttaaacacatcgctatgcacgttgctgcaagcaagccagaattc
atcaaaccggaagacgtatccgctgaagtggtagaaaaagaataccaggtacagctggat
atcgcgatgcagtctggtaagccgaaagaaatcgcagagaaaatggttgaaggccgcatg
aagaaattcaccggcgaagtttctctgaccggtcagccgttcgttatggaaccaagcaaa
actgttggtcagctgctgaaagagcataacgctgaagtgactggcttcatccgcttcgaa
gtgggtgaaggcatcgagaaagttgagactgactttgcagcagaagttgctgcgatgtcc
aagcagtcttaa
              
                            

Download fasta file
RegulonDB