RegulonDB RegulonDB 10.9: Gene Sequence
tufB gene sequence


Size: 1185        A: 290  T: 262  G: 326  C: 307

Fasta

 

>tufB E. coli K12. Version NC_000913.3 GI:556503834
atgtctaaagaaaagtttgaacgtacaaaaccgcacgttaacgtcggtactatcggccac
gttgaccatggtaaaacaacgctgaccgctgcaatcactaccgtactggctaaaacctac
ggcggtgctgctcgcgcattcgaccagatcgataacgcgccggaagaaaaagctcgtggt
atcaccatcaacacttctcacgttgaatacgacaccccgacccgtcactacgcacacgta
gactgcccggggcacgccgactatgttaaaaacatgatcaccggtgctgcgcagatggac
ggcgcgatcctggtagttgctgcgactgacggcccgatgccgcagactcgtgagcacatc
ctgctgggtcgtcaggtaggcgttccgtacatcatcgtgttcctgaacaaatgcgacatg
gttgatgacgaagagctgctggaactggttgaaatggaagttcgtgaacttctgtctcag
tacgacttcccgggcgacgacactccgatcgttcgtggttctgctctgaaagcgctggaa
ggcgacgcagagtgggaagcgaaaatcctggaactggctggcttcctggattcttacatt
ccggaaccagagcgtgcgattgacaagccgttcctgctgccgatcgaagacgtattctcc
atctccggtcgtggtaccgttgttaccggtcgtgtagaacgcggtatcatcaaagttggt
gaagaagttgaaatcgttggtatcaaagagactcagaagtctacctgtactggcgttgaa
atgttccgcaaactgctggacgaaggccgtgctggtgagaacgtaggtgttctgctgcgt
ggtatcaaacgtgaagaaatcgaacgtggtcaggtactggctaagccgggcaccatcaag
ccgcacaccaagttcgaatctgaagtgtacattctgtccaaagatgaaggcggccgtcat
actccgttcttcaaaggctaccgtccgcagttctacttccgtactactgacgtgactggt
accatcgaactgccggaaggcgtagagatggtaatgccgggcgacaacatcaaaatggtt
gttaccctgatccacccgatcgcgatggacgacggtctgcgtttcgcaatccgtgaaggc
ggccgtaccgttggcgcgggcgttgtagcaaaagttctgagctaa
              
                            

Download fasta file
RegulonDB