RegulonDB RegulonDB 10.9: Gene Sequence
tus gene sequence


Size: 930        A: 243  T: 215  G: 227  C: 245

Fasta

 

>tus E. coli K12. Version NC_000913.3 GI:556503834
atggcgcgttacgatctcgtagaccgactcaacactacctttcgccagatggaacaagag
ctggctatatttgccgctcatcttgagcaacacaagctattggttgcccgcgtgttctct
ttgccggaggtaaaaaaagaggatgagcataatccgcttaatcgtattgaggtaaaacaa
catctcggcaacgacgcgcagtcgctggcgttgcgtcatttccgccatttatttattcaa
caacagtccgaaaatcgcagcagcaaggccgctgtccgtctgcctggcgtgttgtgttac
caggtcgataacctttcgcaagcagcgttggtcagtcatattcagcacatcaataaactc
aagaccacgttcgagcatatcgtcacggttgaatcagaactccccaccgcggcacgtttt
gaatgggtgcatcgtcatttgccggggctgatcacccttaatgcttaccgcacgctcacc
gttctgcacgaccccgccactttacgctttggttgggctaataaacatatcattaagaat
ttacatcgtgatgaagtcctggcacagctggaaaaaagcctgaaatcaccacgcagtgtc
gcaccgtggacgcgcgaggagtggcaaagaaaactggagcgagagtatcaggatatcgct
gccctgccacagaacgcgaagttaaaaatcaaacgtccggtgaaggtgcagccgattgcc
cgcgtctggtacaaaggagatcaaaaacaagtccaacacgcctgccctacaccactgatt
gcactgattaatcgggataatggcgcgggcgtgccggacgttggtgagttgttaaattac
gatgccgacaatgtgcagcaccgttataaacctcaggcgcagccgcttcgtttgatcatt
ccacggctgcacctgtatgttgcagattaa
              
                            

Download fasta file
RegulonDB