RegulonDB RegulonDB 11.1: Gene Sequence
tyrR gene sequence


Size: 1542        A: 364  T: 374  G: 441  C: 363

Fasta

 

>tyrR E. coli K12. Version NC_000913.3 GI:556503834
atgcgtctggaagtcttttgtgaagaccgactcggtctgacccgcgaattactcgatcta
ctcgtgctaagaggcattgatttacgcggtattgagattgatcccattgggcgaatctac
ctcaattttgctgaactggagtttgagagtttcagcagtctgatggccgaaatacgccgt
attgcgggtgttaccgatgtgcgtactgtcccgtggatgccttccgaacgtgagcatctg
gcgttgagcgcgttactggaggcgttgcctgaacctgtgctctctgtcgatatgaaaagc
aaagtggatatggcgaacccggcgagctgtcagctttttgggcaaaaattggatcgcctg
cgcaaccataccgccgcacaattgattaacggctttaattttttacgttggctggaaagc
gaaccgcaagattcgcataacgagcatgtcgttattaatgggcagaatttcctgatggag
attacgcctgtttatcttcaggatgaaaatgatcaacacgtcctgaccggtgcggtggtg
atgttgcgatcaacgattcgtatgggccgccagttgcaaaatgtcgccgcccaggacgtc
agcgccttcagtcaaattgtcgccgtcagcccgaaaatgaagcatgttgtcgaacaggcg
cagaaactggcgatgctaagcgcgccgctgctgattacgggtgacacaggtacaggtaaa
gatctctttgcctacgcctgccatcaggcaagccccagagcgggcaaaccttacctggcg
ctgaactgtgcgtctataccggaagatgcggtcgagagtgaactgtttggtcatgctccg
gaagggaagaaaggattctttgagcaggcgaacggtggttcggtgctgttggatgaaata
ggggaaatgtcaccacggatgcaggcgaaattactgcgtttccttaatgatggcactttc
cgtcgggttggcgaagaccatgaggtgcatgtcgatgtgcgggtgatttgcgctacgcag
aagaatctggtcgaactggtgcaaaaaggcatgttccgtgaagatctctattatcgtctg
aacgtgttgacgctcaatctgccgccgctacgtgactgtccgcaggacatcatgccgtta
actgagctgttcgtcgcccgctttgccgacgagcagggcgtgccgcgtccgaaactggcc
gctgacctgaatactgtacttacgcgttatgcgtggccgggaaatgtgcggcagttaaag
aacgctatctatcgcgcactgacacaactggacggttatgagctgcgtccacaggatatt
ttgttgccggattatgacgccgcaacggtagccgtgggcgaagatgcgatggaaggttcg
ctggacgaaatcaccagccgttttgaacgctcggtattaacccagctttatcgcaattat
cccagcacgcgcaaactggcaaaacgtctcggcgtttcacataccgcgattgccaataag
ttgcgggaatatggtctgagtcagaagaagaacgaagagtaa
              
                            

Download fasta file
RegulonDB