RegulonDB RegulonDB 10.9: Gene Sequence
tyrS gene sequence


Size: 1275        A: 322  T: 296  G: 351  C: 306

Fasta

 

>tyrS E. coli K12. Version NC_000913.3 GI:556503834
atggcaagcagtaacttgattaaacaattgcaagagcgggggctggtagcccaggtgacg
gacgaggaagcgttagcagagcgactggcgcaaggcccgatcgcgctctattgcggcttc
gatcctaccgctgacagcttgcatttggggcatcttgttccattgttatgcctgaaacgc
ttccagcaggcgggccacaagccggttgcgctggtaggcggcgcgacgggtctgattggc
gacccgagcttcaaagctgccgagcgtaagctgaacaccgaagaaactgttcaggagtgg
gtggacaaaatccgtaagcaggttgccccgttcctcgatttcgactgtggagaaaactct
gctatcgcggcgaacaactatgactggttcggcaatatgaatgtgctgaccttcctgcgc
gatattggcaaacacttctccgttaaccagatgatcaacaaagaagcggttaagcagcgt
ctcaaccgtgaagatcaggggatttcgttcactgagttttcctacaacctgttgcagggt
tatgacttcgcctgtctgaacaaacagtacggtgtggtgctgcaaattggtggttctgac
cagtggggtaacatcacttctggtatcgacctgacccgtcgtctgcatcagaatcaggtg
tttggcctgaccgttccgctgatcactaaagcagatggcaccaaatttggtaaaactgaa
ggcggcgcagtctggttggatccgaagaaaaccagcccgtacaaattctaccagttctgg
atcaacactgcggatgccgacgtttaccgcttcctgaagttcttcacctttatgagcatt
gaagagatcaacgccctggaagaagaagataaaaacagcggtaaagcaccgcgcgcccag
tatgtactggcggagcaggtgactcgtctggttcacggtgaagaaggtttacaggcggca
aaacgtattaccgaatgcctgttcagcggttctttgagtgcgctgagtgaagcggacttc
gaacagctggcgcaggacggcgtaccgatggttgagatggaaaagggcgcagacctgatg
caggcactggtcgattctgaactgcaaccttcccgtggtcaggcacgtaaaactatcgcc
tccaatgccatcaccattaacggtgaaaaacagtccgatcctgaatacttctttaaagaa
gaagatcgtctgtttggtcgttttaccttactgcgtcgcggtaaaaagaattactgtctg
atttgctggaaataa
              
                            

Download fasta file
RegulonDB