RegulonDB RegulonDB 10.9: Gene Sequence
ubiX gene sequence


Size: 570        A: 117  T: 150  G: 151  C: 152

Fasta

 

>ubiX E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgactcattgtaggcatcagcggtgccagcggcgcgatttatggcgtgcgctta
ttacaggttctgcgcgatgtcacagatatcgaaacgcatctggtgatgagccaggcagcg
cgccagaccttatccctcgaaacggatttttctctgcgcgaagtgcaggcattagccgat
gtcacgcacgatgcgcgcgatattgccgccagcatctcttccggttctttccagacgctg
gggatggtgattttaccctgttcaatcaaaaccctttccggcattgtccatagctatact
gatggcttactgacccgtgcggcagatgtggtgctgaaagagcgtcgcccgttggtgctc
tgcgtgcgtgaaacaccattgcacttaggccatctgcgtttaatgactcaggcggcagaa
atcggtgcggtgattatgcctcccgttccggcgttttatcatcgcccgcaatcccttgat
gatgtgataaatcagacggttaatcgtgttcttgaccagtttgcgataacccttcctgaa
gatctctttgcccgctggcagggcgcataa
              
                            

Download fasta file
RegulonDB