RegulonDB RegulonDB 10.9: Gene Sequence
udp gene sequence


Size: 762        A: 163  T: 187  G: 215  C: 197

Fasta

 

>udp E. coli K12. Version NC_000913.3 GI:556503834
atgtccaagtctgatgtttttcatctcggcctcactaaaaacgatttacaaggggctacg
cttgccatcgtccctggcgacccggatcgtgtggaaaagatcgccgcgctgatggataag
ccggttaagctggcatctcaccgcgaattcactacctggcgtgcagagctggatggtaaa
cctgttatcgtctgctctaccggtatcggcggcccgtctacctctattgctgttgaagag
ctggcacagctgggcattcgcaccttcctgcgtatcggtacaacgggcgctattcagccg
catattaatgtgggtgatgtcctggttaccacggcgtctgtccgtctggatggcgcgagc
ctgcacttcgcaccgctggaattcccggctgtcgctgatttcgaatgtacgactgcgctg
gttgaagctgcgaaatccattggcgcgacaactcacgttggcgtgacagcttcttctgat
accttctacccaggtcaggaacgttacgatacttactctggtcgcgtagttcgtcacttt
aaaggttctatggaagagtggcaggcgatgggcgtaatgaactatgaaatggaatctgca
accctgctgaccatgtgtgcaagtcagggcctgcgtgccggtatggtagcgggtgttatc
gttaaccgcacccagcaagagatcccgaatgctgagacgatgaaacaaaccgaaagccat
gcggtgaaaatcgtggtggaagcggcgcgtcgtctgctgtaa
              
                            

Download fasta file
RegulonDB