RegulonDB RegulonDB 10.10: Gene Sequence
uhpA gene sequence


Size: 591        A: 114  T: 129  G: 191  C: 157

Fasta

 

>uhpA E. coli K12. Version NC_000913.3 GI:556503834
atgatcaccgttgcccttatagacgatcacctcatcgtccgctccggctttgcgcagctg
ctggggctggaacctgatttgcaggtagttgccgagtttggttcggggcgcgaggcgctg
gcggggctgccggggcgcggtgtgcaggtgtgtatttgcgatatctccatgcccgatatc
tccggtctggagctgctaagccagctgccgaaaggtatggcgacgattatgctctccgtt
cacgacagtcctgcgctggttgagcaggcgcttaacgcgggggcacgcggctttctttcc
aaacgctgtagcccggatgaactcattgctgcggtgcatacggttgccacgggcggctgt
tatctgacgccggatattgccattaaactggcatccggtcgtcaggacccgctaaccaaa
cgtgaacgccaggtggcggaaaaactggcgcaaggaatggcggtgaaagagattgccgcc
gaactgggcttgtcaccgaaaacggtacacgtccatcgcgccaatctgatggaaaaactg
ggcgtcagtaacgacgtagagctggcgcgccgcatgtttgatggctggtga
              
                            

Download fasta file
RegulonDB