RegulonDB RegulonDB 10.9: Gene Sequence
uhpC gene sequence


Size: 1320        A: 230  T: 364  G: 405  C: 321

Fasta

 

>uhpC E. coli K12. Version NC_000913.3 GI:556503834
atgttgccgtttctgaaagcgcctgccgatgcgccattaatgactgataaatatgaaatt
gatgcccgctatcgctactggcgtcggcatattctgctgaccatctggctgggttacgcg
ctgttttacttcacgcggaaaagttttaacgccgccgtaccagaaatccttgctaacggc
gtgctcagccgtagcgatatcggcctgttagcgaccctgttttacattacctatggcgtg
tcgaagtttgtctccggcattgtcagcgatcgctcaaatgcccgttattttatggggata
gggcttatcgccacgggcattatcaacattctgtttggcttctcgacgtcgctatgggcg
tttgccgtgctctgggtgctgaacgcctttttccagggctggggttcaccggtgtgtgcg
cgtctgttaacggcctggtattcacgtaccgagcgcggcggttggtgggcattatggaac
acggcgcataacgtcggcggcgcactcattcccattgtgatggcagcggctgcgctgcat
tacggctggcgtgccgggatgatgattgctggttgtatggcgatagtcgtggggattttt
ctctgctggcggctacgcgatcgcccgcaggcgttaggtttaccggcggtcggtgaatgg
cgacacgacgcgctggaaattgctcaacaacaagaaggggcagggttgacgcgtaaagag
atcctcaccaaatatgtgttgctgaatccgtatatctggctgctttcgttttgctatgtg
ctggtctatgtggtccgggcggcgatcaacgactggggcaatttgtatatgtccgagaca
ctgggcgtcgatctggtcacggcgaatacggcagtgacgatgtttgaactgggcggattt
atcggtgcgctggtagccggttggggctcggacaaattgtttaacggcaaccgagggccg
atgaatttgattttcgccgccggaattttgctttcagtcggctccctgtggctgatgcca
tttgccagctacgtgatgcaggcaacctgcttcttcaccattggtttttttgtctttggc
ccacagatgttaatcggtatggcggcggcagagtgttcccacaaagaggcggcaggggcg
gcgacggggtttgtcggcttgtttgcttatctgggggcgtcgcttgctggttggccgctg
gcgaaagtactcgatacctggcactggagcggattttttgtggttatctctatcgccgcc
gggatttccgcactgctgttactgccctttttgaacgcccagacaccgcgcgaagcgtga
              
                            

Download fasta file
RegulonDB