RegulonDB RegulonDB 10.9: Gene Sequence
uidA gene sequence


Size: 1812        A: 466  T: 399  G: 513  C: 434

Fasta

 

>uidA E. coli K12. Version NC_000913.3 GI:556503834
atgttacgtcctgtagaaaccccaacccgtgaaatcaaaaaactcgacggcctgtgggca
ttcagtctggatcgcgaaaactgtggaattgatcagcgttggtgggaaagcgcgttacaa
gaaagccgggcaattgctgtgccaggcagttttaacgatcagttcgccgatgcagatatt
cgtaattatgcgggcaacgtctggtatcagcgcgaagtctttataccgaaaggttgggca
ggccagcgtatcgtgctgcgtttcgatgcggtcactcattacggcaaagtgtgggtcaat
aatcaggaagtgatggagcatcagggcggctatacgccatttgaagccgatgtcacgccg
tatgttattgccgggaaaagtgtacgtatcaccgtttgtgtgaacaacgaactgaactgg
cagactatcccgccgggaatggtgattaccgacgaaaacggcaagaaaaagcagtcttac
ttccatgatttctttaactatgccgggatccatcgcagcgtaatgctctacaccacgccg
aacacctgggtggacgatatcaccgtggtgacgcatgtcgcgcaagactgtaaccacgcg
tctgttgactggcaggtggtggccaatggtgatgtcagcgttgaactgcgtgatgcggat
caacaggtggttgcaactggacaaggcactagcgggactttgcaagtggtgaatccgcac
ctctggcaaccgggtgaaggttatctctatgaactgtgcgtcacagccaaaagccagaca
gagtgtgatatctacccgcttcgcgtcggcatccggtcagtggcagtgaagggcgaacag
ttcctgattaaccacaaaccgttctactttactggctttggtcgtcatgaagatgcggac
ttgcgtggcaaaggattcgataacgtgctgatggtgcacgaccacgcattaatggactgg
attggggccaactcctaccgtacctcgcattacccttacgctgaagagatgctcgactgg
gcagatgaacatggcatcgtggtgattgatgaaactgctgctgtcggctttaacctctct
ttaggcattggtttcgaagcgggcaacaagccgaaagaactgtacagcgaagaggcagtc
aacggggaaactcagcaagcgcacttacaggcgattaaagagctgatagcgcgtgacaaa
aaccacccaagcgtggtgatgtggagtattgccaacgaaccggatacccgtccgcaaggt
gcacgggaatatttcgcgccactggcggaagcaacgcgtaaactcgacccgacgcgtccg
atcacctgcgtcaatgtaatgttctgcgacgctcacaccgataccatcagcgatctcttt
gatgtgctgtgcctgaaccgttattacggatggtatgtccaaagcggcgatttggaaacg
gcagagaaggtactggaaaaagaacttctggcctggcaggagaaactgcatcagccgatt
atcatcaccgaatacggcgtggatacgttagccgggctgcactcaatgtacaccgacatg
tggagtgaagagtatcagtgtgcatggctggatatgtatcaccgcgtctttgatcgcgtc
agcgccgtcgtcggtgaacaggtatggaatttcgccgattttgcgacctcgcaaggcata
ttgcgcgttggcggtaacaagaaagggatcttcactcgcgaccgcaaaccgaagtcggcg
gcttttctgctgcaaaaacgctggactggcatgaacttcggtgaaaaaccgcagcaggga
ggcaaacaatga
              
                            

Download fasta file
RegulonDB