RegulonDB RegulonDB 10.10: Gene Sequence
umuC gene sequence


Size: 1269        A: 313  T: 309  G: 360  C: 287

Fasta

 

>umuC E. coli K12. Version NC_000913.3 GI:556503834
atgtttgccctctgtgatgtaaacgcgttttatgccagctgtgagacggtgtttcgccct
gatttatggggtaaaccggtggttgtgctatcgaataatgacggttgcgttatcgcccga
aacgctgaggcaaaggcgcttggcgttaaaatgggcgatccctggttcaaacaaaaagat
ctgtttcgtcgctgtggcgtggtttgctttagcagcaattatgagctttacgcagacatg
agcaatcgggtgatgtcgacgctggaagagctatcgccccgcgtcgagatttacagtatt
gatgaggcattctgcgatctgacaggtgtgcgtaattgtcgcgatctgactgattttggc
agagaaattcgcgcaacggtgctacaacgtacccatcttactgttggtgtggggatcgcc
cagaccaaaacgctggctaagcttgccaatcatgcggcaaaaaaatggcagcggcagacg
ggtggggtggtggatttatcaaatctggaacgccagcgtaaattaatgtctgctctcccc
gtggatgacgtctgggggattggacggcggatcagcaaaaaactggacgcgatggggatc
aaaaccgttctcgatttggcggatacagatatccggtttatccgtaaacattttaatgtc
gtgctcgaaagaacggtgcgtgaactgcgcggcgaaccctgtttgcaactggaagagttt
gcaccgacgaagcaggaaattatctgttcccgctcgtttggtgaacgcatcacggattat
ccgtcgatgcggcaggccatttgtagttacgctgcccgggcggcggaaaaacttcgcagc
gagcatcaatattgtcggtttatctccacgtttattaagacgtcaccatttgcgctcaat
gaaccttattacggcaatagcgcgtcggtaaaactgctgacgcccactcaggacagcagg
gatatcattaacgctgctacgcgatctctggatgccatctggcaagcgggccatcgttac
caaaaagcgggcgtgatgctgggggatttcttcagtcagggagtcgcgcagctcaattta
ttcgatgacaacgcaccgcgccccgggagtgagcaattgatgacggtaatggatacactg
aatgctaaagagggcagaggaacactctattttgccgggcaggggatccagcaacaatgg
cagatgaagcgagccatgctttcaccacgttatacaacgcgaagttctgatttactgagg
gtcaaataa
              
                            

Download fasta file
RegulonDB