RegulonDB RegulonDB 10.10: Gene Sequence
ung gene sequence


Size: 690        A: 163  T: 167  G: 184  C: 176

Fasta

 

>ung E. coli K12. Version NC_000913.3 GI:556503834
atggctaacgaattaacctggcatgacgtgctggctgaagagaagcagcaaccctatttt
cttaatacccttcagaccgtcgccagcgagcggcagtccggcgtcactatctacccacca
caaaaagatgtctttaacgcgttccgctttacagagttgggtgacgttaaagtggtgatt
ctcggccaggatccttatcacggaccgggacaggcgcatggtctggcattttccgttcgt
cccggcattgccattcctccgtcattattgaatatgtataaagagctggaaaatactatt
ccgggcttcacccgccctaatcatggttatcttgaaagctgggcgcgtcagggcgttctg
ctactcaatactgtgttgacggtacgcgcaggtcaggcgcattcccacgccagcctcggc
tgggaaaccttcaccgataaagtgatcagcctgattaaccagcatcgcgaaggcgtggtg
tttttgttgtggggatcgcatgcgcaaaagaaaggggcgattatagataagcaacgccat
catgtactgaaagcaccgcatccgtcgccgctttcggcgcatcgtggattctttggctgc
aaccattttgtgctggcaaatcagtggctggaacaacgtggcgagacgccgattgactgg
atgccagtattaccggcagagagtgagtaa
              
                            

Download fasta file
RegulonDB