RegulonDB RegulonDB 10.9: Gene Sequence
vsr gene sequence


Size: 471        A: 100  T: 107  G: 147  C: 117

Fasta

 

>vsr E. coli K12. Version NC_000913.3 GI:556503834
atggccgacgttcacgataaggccactcgcagcaaaaatatgcgcgcgattgccacgcgt
gatacggcgatagagaagcgcctcgccagtctgttaaccgggcagggcctggcatttcgc
gttcaggacgccagtctgcccggacgtccggattttgtcgttgatgaatatcgctgcgtg
atatttacccatggctgcttctggcatcatcatcactgctatctgtttaaagtgcctgcg
actcgaaccgagttctggctggagaagataggtaaaaatgttgagcgcgatcgccgcgat
atcagtcgcttgcaggaactcggctggcgcgtattgattgtctgggagtgcgcgttacgt
gggcgcgagaagctgacggatgaagcgcttaccgagcgtctggaagagtggatctgcggc
gaaggtgccagcgcgcagatcgacacgcaggggattcatttactcgcttga
              
                            

Download fasta file
RegulonDB