RegulonDB RegulonDB 10.8: Gene Sequence
xthA gene sequence


Size: 807        A: 204  T: 172  G: 217  C: 214

Fasta

 

>xthA E. coli K12. Version NC_000913.3 GI:556503834
atgaaatttgtctcttttaatatcaacggcctgcgcgccagacctcaccagcttgaagcc
atcgtcgaaaagcaccaaccggatgtgattggcctgcaggagacaaaagttcatgacgat
atgtttccgctcgaagaggtggcgaagctcggctacaacgtgttttatcacgggcagaaa
ggccattatggcgtggcgctgctgaccaaagagacgccgattgccgtgcgtcgcggcttt
cccggtgacgacgaagaggcgcagcggcggattattatggcggaaatcccctcactgctg
ggtaatgtcaccgtgatcaacggttacttcccgcagggtgaaagccgcgaccatccgata
aaattcccggcaaaagcgcagttttatcagaatctgcaaaactacctggaaaccgaactc
aaacgtgataatccggtactgattatgggcgatatgaatatcagccctacagatctggat
atcggcattggcgaagaaaaccgtaagcgctggctgcgtaccggtaaatgctctttcctg
ccggaagagcgcgaatggatggacaggctgatgagctgggggttggtcgataccttccgc
catgcgaatccgcaaacagcagatcgtttctcatggtttgattaccgctcaaaaggtttt
gacgataaccgtggtctgcgcatcgacctgctgctcgccagccaaccgctggcagaatgt
tgcgtagaaaccggcatcgactatgaaatccgcagcatggaaaaaccgtccgatcacgcc
cccgtctgggcgaccttccgccgctaa
              
                            

Download fasta file
RegulonDB