RegulonDB RegulonDB 11.1: Gene Sequence
xylA gene sequence


Size: 1323        A: 340  T: 310  G: 366  C: 307

Fasta

 

>xylA E. coli K12. Version NC_000913.3 GI:556503834
atgcaagcctattttgaccagctcgatcgcgttcgttatgaaggctcaaaatcctcaaac
ccgttagcattccgtcactacaatcccgacgaactggtgttgggtaagcgtatggaagag
cacttgcgttttgccgcctgctactggcacaccttctgctggaacggggcggatatgttt
ggtgtgggggcgtttaatcgtccgtggcagcagcctggtgaggcactggcgttggcgaag
cgtaaagcagatgtcgcatttgagtttttccacaagttacatgtgccattttattgcttc
cacgatgtggatgtttcccctgagggcgcgtcgttaaaagagtacatcaataattttgcg
caaatggttgatgtcctggcaggcaagcaagaagagagcggcgtgaagctgctgtgggga
acggccaactgctttacaaaccctcgctacggcgcgggtgcggcgacgaacccagatcct
gaagtcttcagctgggcggcaacgcaagttgttacagcgatggaagcaacccataaattg
ggcggtgaaaactatgtcctgtggggcggtcgtgaaggttacgaaacgctgttaaatacc
gacttgcgtcaggagcgtgaacaactgggccgctttatgcagatggtggttgagcataaa
cataaaatcggtttccagggcacgttgcttatcgaaccgaaaccgcaagaaccgaccaaa
catcaatatgattacgatgccgcgacggtctatggcttcctgaaacagtttggtctggaa
aaagagattaaactgaacattgaagctaaccacgcgacgctggcaggtcactctttccat
catgaaatagccaccgccattgcgcttggcctgttcggttctgtcgacgccaaccgtggc
gatgcgcaactgggctgggacaccgaccagttcccgaacagtgtggaagagaatgcgctg
gtgatgtatgaaattctcaaagcaggcggtttcaccaccggtggtctgaacttcgatgcc
aaagtacgtcgtcaaagtactgataaatatgatctgttttacggtcatatcggcgcgatg
gatacgatggcactggcgctgaaaattgcagcgcgcatgattgaagatggcgagctggat
aaacgcatcgcgcagcgttattccggctggaatagcgaattgggccagcaaatcctgaaa
ggccaaatgtcactggcagatttagccaaatatgctcaggaacatcatttgtctccggtg
catcagagtggtcgccaggaacaactggaaaatctggtaaaccattatctgttcgacaaa
taa
              
                            

Download fasta file
RegulonDB