RegulonDB RegulonDB 10.9: Gene Sequence
xylE gene sequence


Size: 1476        A: 307  T: 437  G: 377  C: 355

Fasta

 

>xylE E. coli K12. Version NC_000913.3 GI:556503834
atgaatacccagtataattccagttatatattttcgattaccttagtcgctacattaggt
ggtttattatttggctacgacaccgccgttatttccggtactgttgagtcactcaatacc
gtctttgttgctccacaaaacttaagtgaatccgctgccaactccctgttagggttttgc
gtggccagcgctctgattggttgcatcatcggcggtgccctcggtggttattgcagtaac
cgcttcggtcgtcgtgattcacttaagattgctgctgtcctgttttttatttctggtgta
ggttctgcctggccagaacttggttttacctctataaacccggacaacactgtgcctgtt
tatctggcaggttatgtcccggaatttgttatttatcgcattattggcggtattggcgtt
ggtttagcctcaatgctctcgccaatgtatattgcggaactggctccagctcatattcgc
gggaaactggtctcttttaaccagtttgcgattattttcgggcaacttttagtttactgc
gtaaactattttattgcccgttccggtgatgccagctggctgaatactgacggctggcgt
tatatgtttgcctcggaatgtatccctgcactgctgttcttaatgctgctgtataccgtg
ccagaaagtcctcgctggctgatgtcgcgcggcaagcaagaacaggcggaaggtatcctg
cgcaaaattatgggcaacacgcttgcaactcaggcagtacaggaaattaaacactccctg
gatcatggccgcaaaaccggtggtcgtctgctgatgtttggcgtgggcgtgattgtaatc
ggcgtaatgctctccatcttccagcaatttgtcggcatcaatgtggtgctgtactacgcg
ccggaagtgttcaaaacgctgggggccagcacggatatcgcgctgttgcagaccattatt
gtcggagttatcaacctcaccttcaccgttctggcaattatgacggtggataaatttggt
cgtaagccactgcaaattatcggcgcactcggaatggcaatcggtatgtttagcctcggt
accgcgttttacactcaggcaccgggtattgtggcgctactgtcgatgctgttctatgtt
gccgcctttgccatgtcctggggtccggtatgctgggtactgctgtcggaaatcttcccg
aatgctattcgtggtaaagcgctggcaatcgcggtggcggcccagtggctggcgaactac
ttcgtctcctggaccttcccgatgatggacaaaaactcctggctggtggcccatttccac
aacggtttctcctactggatttacggttgtatgggcgttctggcagcactgtttatgtgg
aaatttgtcccggaaaccaaaggtaaaacccttgaggagctggaagcgctctgggaaccg
gaaacgaagaaaacacaacaaactgctacgctgtaa
              
                            

Download fasta file
RegulonDB