RegulonDB RegulonDB 10.9: Gene Sequence
mraZ gene sequence


Size: 459        A: 115  T: 105  G: 129  C: 110

Fasta

 

>mraZ E. coli K12. Version NC_000913.3 GI:556503834
atgttccggggagcaacgttagtcaatctcgacagcaaagggcgcttatcagtgcctacc
cgttatcgggaacagctgcttgagaacgctgccggtcaaatggtttgcaccattgacatt
tatcacccgtgcctgctgctttaccccctgcctgaatgggaaattatcgagcaaaaatta
tcgcgtctgtcgagcatgaacccggttgagcgccgtgtgcagcgcctactgttaggtcat
gccagcgaatgtcagatggatggcgcaggtcgattgttaatcgcgccagtactgcggcaa
catgccgggctgacaaaagaagtgatgctggttggacagttcaacaagtttgagctgtgg
gatgaaacaacctggcatcaacaggtcaaggaagatatcgacgcagagcagttggctacc
ggagacttatcggagcgactgcaggacttgtctctataa
              
                            

Download fasta file
RegulonDB