RegulonDB RegulonDB 10.9: Gene Sequence
rsmH gene sequence


Size: 942        A: 216  T: 206  G: 272  C: 248

Fasta

 

>rsmH E. coli K12. Version NC_000913.3 GI:556503834
atgatggaaaactataaacatactacggtgctgctggatgaagccgttaatggcctcaat
atccgtcctgatggcatctacattgatgggacttttggtcgcggtggtcactcacgtctg
atcctctcgcagcttggcgaagaggggcgtttgctggcgatcgatcgcgacccgcaggct
atcgccgttgcgaagactattgatgatccgcgcttctccatcatccacggacctttctcc
gcgctgggcgaatacgttgccgagcgcgatcttatcggcaagatcgacggcattctcctc
gatcttggcgtctcttcaccgcaacttgatgatgctgaacgtggcttttcctttatgcgc
gatggtccgctggacatgcgtatggacccaacccgtgggcagtcagccgctgaatggcta
caaaccgcagaagaagccgatatcgcctgggtattgaaaacctatggtgaagagcgtttt
gccaaacgcattgcccgcgccattgtcgagcgtaaccgcgaacagccgatgacccgcacc
aaagaactggcggaagtcgtggctgctgcaacgccggtgaaagataagtttaaacatccc
gcgacccgtaccttccaggcggtgcgcatttgggtaaacagtgaactggaggagatagag
caggcgctaaaaagctcgctcaacgtgctggccccgggtgggcggctttcgatcatcagc
ttccactcgctggaagaccgtattgtgaaacgttttatgcgtgaaaacagccgcggtccg
caagttccggcagggttaccgatgactgaagagcagctcaaaaaactgggtggccgtcag
ctgcgagcactaggcaagttaatgccgggcgaagaagaggtggctgagaaccctcgtgcc
cgtagttcagttctgcgtattgcagagaggacgaatgcatga
              
                            

Download fasta file
RegulonDB