RegulonDB RegulonDB 10.10: Gene Sequence
ftsL gene sequence


Size: 366        A: 100  T: 82  G: 101  C: 83

Fasta

 

>ftsL E. coli K12. Version NC_000913.3 GI:556503834
atgatcagcagagtgacagaagctctaagcaaagttaaaggatcgatgggaagccacgag
cgccatgcattgcctggtgttatcggtgacgatcttttgcgatttgggaagctgccactc
tgcctgttcatttgcattattttgacggcggtgactgtggtaaccacggcgcaccatacc
cgtttactgaccgctcagcgcgaacaactggtgctggagcgagatgctttagacattgaa
tggcgcaacctgatccttgaagagaatgcgctcggcgaccatagccgggtggaaaggatc
gccacggaaaagctgcaaatgcagcatgttgatccgtcacaagaaaatatcgtagtgcaa
aaataa
              
                            

Download fasta file
RegulonDB