RegulonDB RegulonDB 10.9: Gene Sequence
secM gene sequence


Size: 513        A: 122  T: 114  G: 122  C: 155

Fasta

 

>secM E. coli K12. Version NC_000913.3 GI:556503834
gtgagtggaatactgacgcgctggcgacagtttggtaaacgctacttctggccgcatctc
ttattagggatggttgcggcgagtttaggtttgcctgcgctcagcaacgccgccgaacca
aacgcgcccgcaaaagcgacaacccgcaaccacgagccttcagccaaagttaactttggt
caattggccttgctggaagcgaacacacgccgcccgaattcgaactattccgttgattac
tggcatcaacatgccattcgcacggtaatccgtcatctttctttcgcaatggcaccgcaa
acactgcccgttgctgaagaatctttgcctcttcaggcgcaacatcttgcattactggat
acgctcagcgcgctgctgacccaggaaggcacgccgtctgaaaagggttatcgcattgat
tatgcgcattttaccccacaagcaaaattcagcacgcccgtctggataagccaggcgcaa
ggcatccgtgctggccctcaacgcctcacctaa
              
                            

Download fasta file
RegulonDB