RegulonDB RegulonDB 10.9: Gene Sequence
pdhR gene sequence


Size: 765        A: 178  T: 160  G: 208  C: 219

Fasta

 

>pdhR E. coli K12. Version NC_000913.3 GI:556503834
atggcctacagcaaaatccgccaaccaaaactctccgatgtgattgagcagcaactggag
tttttgatcctcgaaggcactctccgcccgggcgaaaaactcccaccggaacgcgaactg
gcaaaacagtttgacgtctcccgtccctccttgcgtgaggcgattcaacgtctcgaagcg
aagggcttgttgcttcgtcgccagggtggcggcacttttgtccagagcagcctatggcaa
agcttcagcgatccgctggtggagctgctctccgaccatcctgagtcacagtatgacttg
ctcgaaacacgacacgccctggaaggtatcgccgcttattacgccgcgctgcgtagtacc
gatgaagacaaggaacgcatccgtgaactccaccacgccatagagctggcgcagcagtct
ggcgatctggacgcggaatcaaacgccgtactccagtatcagattgccgtcaccgaagcg
gcccacaatgtggttctgcttcatctgctaaggtgtatggagccgatgttggcccagaat
gtccgccagaacttcgaattgctctattcgcgtcgcgagatgctgccgctggtgagtagt
caccgcacccgcatatttgaagcgattatggccggtaagccggaagaagcgcgcgaagca
tcgcatcgccatctggcctttatcgaagaaattttgctcgacagaagtcgtgaagagagc
cgccgtgagcgttctctgcgtcgtctggagcaacgaaagaattag
              
                            

Download fasta file
RegulonDB