RegulonDB RegulonDB 10.9: Gene Sequence
mtn gene sequence


Size: 699        A: 163  T: 170  G: 189  C: 177

Fasta

 

>mtn E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatcggcatcattggtgcaatggaagaagaagttacgctgctgcgtgacaaaatc
gaaaaccgtcaaactatcagtctcggcggttgcgaaatctataccggccaactgaatgga
accgaggttgcgcttctgaaatcgggcatcggtaaagtcgctgcggcgctgggtgccact
ttgctgttggaacactgcaagccagatgtgattattaacaccggttctgccggtggcctg
gcaccaacgttgaaagtgggcgatatcgttgtctcggacgaagcacgttatcacgacgcg
gatgtcacggcatttggttatgaatacggtcagttaccaggctgtccggcaggctttaaa
gctgacgataaactgatcgctgccgctgaggcctgcattgccgaactgaatcttaacgct
gtacgtggcctgattgttagcggcgacgctttcatcaacggttctgttggtctggcgaaa
atccgccacaacttcccacaggccattgctgtagagatggaagcgacggcaatcgcccat
gtctgccacaatttcaacgtcccgtttgttgtcgtacgcgccatctccgacgtggccgat
caacagtctcatcttagcttcgatgagttcctggctgttgccgctaaacagtccagcctg
atggttgagtcactggtgcagaaacttgcacatggctaa
              
                            

Download fasta file
RegulonDB