RegulonDB RegulonDB 10.9: Gene Sequence
frsA gene sequence


Size: 1245        A: 278  T: 299  G: 340  C: 328

Fasta

 

>frsA E. coli K12. Version NC_000913.3 GI:556503834
atgacacaggcaaacctgagcgaaaccctgttcaaaccccgctttaaacatcctgaaacc
tcgacgctagtccgccgctttaatcacggcgcacaaccgcctgtgcagtcggcccttgat
ggtaaaaccatccctcactggtatcgcatgattaaccgtctgatgtggatctggcgcggc
attgacccacgcgaaatcctcgacgtccaggcacgtattgtgatgagcgatgccgaacgt
accgacgatgatttatacgatacggtgattggctaccgtggcggcaactggatttatgag
tgggccacccaggcgatggtgtggcaacaaaaagcctgtgcggaagacgatccgcaactc
agtggtcgtcactggctgcatgcggctacgttgtacaacattgccgcctatcctcatctg
aaaggagatgacctggccgagcaagcgcaggctttgtcaaaccgcgcctatgaagaggcc
gctcagcgtctaccgggcacgatgcggcagatggagtttaccgtacccggcggtgcgccc
atcaccggctttttgcatatgccgaaaggcgatggcccgttcccgacggtattaatgtgt
ggtggtctggatgcgatgcagacggactattacagcctgtatgaacgttattttgcgccg
cgcggcattgcgatgctgactattgatatgccgtcggtgggcttttcttcaaaatggaag
ctcacccaggactccagcctgttgcatcagcacgtcttaaaggcgctgcctaacgtaccg
tgggtggatcacactcgcgtcgcggcctttggtttccgtttcggcgctaacgttgccgtg
cgtctggcataccttgaatcgccgcgtctgaaagcggttgcctgtcttggtccggtagtt
cataccctgttgagtgattttaagtgccagcaacaggtgccggaaatgtatcttgacgtt
ctggccagtcgtttggggatgcatgatgcttccgatgaagcgttgcgcgtggagctgaat
cgctattcattaaaagtgcaaggattgctgggacgtcgctgcccaacgccaatgttatca
ggctactggaagaacgatccgttcagcccggaagaggactcacgcttaatcacctcatca
tctgctgacggtaaattattagagatcccatttaacccggtgtatcggaattttgacaaa
ggtcttcaggaaatcaccgactggatcgaaaaacgcttgtgttaa
              
                            

Download fasta file
RegulonDB