RegulonDB RegulonDB 10.9: Gene Sequence
yaiA gene sequence


Size: 192        A: 67  T: 32  G: 46  C: 47

Fasta

 

>yaiA E. coli K12. Version NC_000913.3 GI:556503834
atgccaacgaaaccgccttatcctcgtgaagcatatatagtgacgattgaaaaaggaaag
ccaggacagacggtaacctggtaccaactcagagccgatcatcctaaaccagactcgttg
atcagtgaacatccgaccgctcaggaagcgatggatgcgaaaaaacgctatgaggaccct
gacaaagagtga
              
                            

Download fasta file
RegulonDB