RegulonDB RegulonDB 10.9: Gene Sequence
fimZ gene sequence


Size: 633        A: 208  T: 193  G: 117  C: 115

Fasta

 

>fimZ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaccaacgtcggtgatcattatggatactcatcctatcatcagaatgtctattgaa
gttctgttgcaaaaaaacagtgaattgcagattgtcctgaaaacggatgattatcgcata
accatcgattatctccgaacccgtcctgttgatttaatcattatggatatagacttgccc
ggaacagacggttttaccttcctgaaaaggatcaaacaaatccagagcacagtgaaagtg
ttatttttatcatcgaaatcagaatgcttttatgctggcagagcgatacaagctggtgct
aacggttttgtcagtaaatgcaatgatcagaatgatatttttcatgccgttcagatgatc
ctctccggatacacgttttttcccagcgaaacgcttaactatataaaaagcaataaatgt
agtacgaatagttcaacggtcactgtgctatctaatcgtgaagtgaccatattacgttat
ctggttagcggattatctaataaagaaattgccgataagttattacttagcaataaaaca
gttagtgcgcataaatctaatatttatggcaagctaggtttgcattcaattgtagagctt
atcgactacgccaaattatacgaattaatataa
              
                            

Download fasta file
RegulonDB