RegulonDB RegulonDB 10.9: Gene Sequence
entH gene sequence


Size: 414        A: 90  T: 89  G: 134  C: 101

Fasta

 

>entH E. coli K12. Version NC_000913.3 GI:556503834
atgatctggaaacgccatttaacgctcgacgaactgaacgccaccagcgataacacaatg
gtggcgcatctgggaattgtgtatacccgtctgggcgatgatgtgctggaagccgaaatg
ccggttgatacccgtactcatcagccgttcggtttactacatggcggcgcgtcggcggcg
ctggcggaaacgctgggatcgatggccggatttatgatgacccgcgacggacagtgtgtg
gtaggcacagaacttaatgcaacacaccatcgcccggtgtctgagggaaaggtacgcggc
gtctgccagccgctgcatcttggtcggcaaaatcagagctgggaaatcgtcgttttcgat
gaacaggggcggcgttgctgcacttgtcggctgggtacggcagttttgggatga
              
                            

Download fasta file
RegulonDB