RegulonDB RegulonDB 10.9: Gene Sequence
mngR gene sequence


Size: 723        A: 204  T: 171  G: 183  C: 165

Fasta

 

>mngR E. coli K12. Version NC_000913.3 GI:556503834
atgggacacaagcccttataccggcagattgccgatcgcattcgtgaacaaattgcgcgt
ggcgagcttaaacctggcgatgcgttacccactgaatcagcgctacaaacagagtttggc
gtcagccgggttacggtgcgtcaggctttgcgccagctagtcgagcagcagatcctcgaa
agcattcagggcagcgggacttacgtcaaagaagagcgggtcaattacgatatttttcag
ttaaccagttttgatgaaaaactgtcggaccgtcacgtcgatacacacagtgaagttctg
atattcgaagtgattccggctgacgattttcttcagcaacagctacaaatcaccccgcag
gatcgtgtgtggcatgtgaagcgcgtgcgctatcgcaagcaaaagccaatggcgctggaa
gaaacctggatgccgcttgcgttgttcccggatctcacctggcaggtcatggaaaattcg
aaatatcactttatcgaagaagtgaagaaaatggttatcgatcgtagcgaacaggaaatc
attcctctgatgccaaccgaagagatgagccgtctgcttaatatcagccagacaaagccg
attcttgaaaaagtatcgcgtggatatttagttgatggtcgggtgtttgaatatagccgc
aacgcttttaataccgatgactataaatttaccctgatagcgcagcgaaaatcatcgcga
taa
              
                            

Download fasta file
RegulonDB