RegulonDB RegulonDB 10.9: Gene Sequence
ybgC gene sequence


Size: 405        A: 97  T: 107  G: 107  C: 94

Fasta

 

>ybgC E. coli K12. Version NC_000913.3 GI:556503834
gtgaatacaacgctgtttcgatggccggttcgcgtctactatgaagataccgatgccggt
ggtgtggtgtaccacgccagttacgtcgctttttatgaaagagcacgcacagagatgctg
cgtcatcatcacttcagtcagcaggcgctgatggctgaacgcgttgcctttgtggtacgt
aaaatgacggtggaatattacgcacctgcgcggctcgacgatatgctcgaaatacagact
gaaataacatcaatgcgtggcacctctttggttttcacgcaacgtattgtcaacgccgag
aatactttgctgaatgaagcagaggttctggttgtttgcgttgacccactcaaaatgaag
cctcgtgcgcttcccaagtctattgtcgcggagtttaagcagtga
              
                            

Download fasta file
RegulonDB