RegulonDB RegulonDB 10.9: Gene Sequence
cspD gene sequence


Size: 225        A: 61  T: 55  G: 61  C: 48

Fasta

 

>cspD E. coli K12. Version NC_000913.3 GI:556503834
atggaaaagggtactgttaagtggttcaacaatgccaaagggtttggtttcatctgccct
gaaggcggcggcgaagatattttcgctcattattccaccattcagatggatggttacaga
acgctaaaagctggacaatccgttcagtttgatgtccaccaggggccaaaaggcaatcac
gccagtgttattgtgcccgtcgaagtagaagcggcagtcgcatag
              
                            

Download fasta file
RegulonDB