RegulonDB RegulonDB 10.9: Gene Sequence
aat gene sequence


Size: 705        A: 143  T: 181  G: 187  C: 194

Fasta

 

>aat E. coli K12. Version NC_000913.3 GI:556503834
atgcgcctggttcagctttctcgccattcaatagccttcccttccccggaaggcgcatta
cgtgagcctaacggcctgctggcacttgggggcgatcttagccctgcgcgcctgttaatg
gcttaccagcgtggtatttttccgtggttttctccaggcgaccccatcctctggtggtcg
cccgatccccgcgcggtgctatggccagaatcactgcatatcagccgtagtatgaagcga
tttcataaacgctcgccctatcgtgtcacgatgaattacgcttttggtcaggtcattgaa
ggctgtgccagcgatcgcgaagaaggaacctggatcacgcgtggcgtggtcgaagcctac
catcgccttcacgaactcggccatgcccactccattgaagtctggcgtgaagatgagctt
gtcggcggtatgtacggcgtggcccagggaacgctattttgtggcgagtccatgttcagc
cggatggaaaatgcgtctaaaacggcgcttctggtattctgtgaggaatttatcggtcat
ggcggtaagcttatcgactgccaggtccttaacgatcacacagcatcgcttggtgcctgc
gaaattccccgccgggattaccttaattatctcaatcaaatgcgcctcggacgattgccg
aataatttctgggtaccacgatgcttgttttcaccacaagaatga
              
                            

Download fasta file
RegulonDB