RegulonDB RegulonDB 10.9: Gene Sequence
yccA gene sequence


Size: 660        A: 120  T: 202  G: 171  C: 167

Fasta

 

>yccA E. coli K12. Version NC_000913.3 GI:556503834
atggatcgtattgttagttcttcacatgaccgtacatcactgcttagcacccataaggtg
ctgcgtaatacctattttctgctgagcctgacgctggccttttcggcgattaccgcaact
gccagtacggtgctgatgctgccatctccgggtctgattctgacgctggtgggtatgtat
ggtttgatgttcctgacctataaaacggcgaataagccgaccgggattatctccgcattc
gcctttaccggttttctgggttatatcctcggacctattctgaacacctatctgtctgcc
ggaatgggtgacgtaatcgctatggcactgggcggaacggcgttagtgttcttctgctgc
tctgcatatgtgctgaccacccgcaaagatatgtcgttcctcggcggtatgctgatggcg
ggtattgtggtggtgctgattggtatggttgcgaatatcttcctgcagctgcctgctctg
catctggcgatcagcgcggtcttcattctgatctcctctggcgctatcttgtttgaaacc
agcaacatcattcatggcggtgagacgaactatattcgtgccacggttagcctgtatgtt
tcgctgtacaacatcttcgtcagcctgctgagcattctgggcttcgctagccgcgattaa
              
                            

Download fasta file
RegulonDB