RegulonDB RegulonDB 10.9: Gene Sequence
rluC gene sequence


Size: 960        A: 242  T: 224  G: 282  C: 212

Fasta

 

>rluC E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacagagactccatccgtaaaaattgttgctatcaccgctgacgaagcggggcaa
cgtatcgataactttttgcgtacccaattgaaaggcgtaccaaaaagtatgatttaccgt
attttgcgtaaaggcgaagtgcgggtgaacaaaaaacgtattaagcctgaatataaactc
gaagcgggtgatgaggtgcgtattccaccggttcgcgttgctgagcgggaagaagaggcg
gtttcgccacatctgcaaaaggtggcggcgctggcggacgtcatcttatatgaagatgat
cacatcctggtgctgaataaaccttccggtacggcggtacatggcggcagtggtttaagc
ttcggcgttattgaaggtttgcgggcgttgcgcccggaagcgcggttccttgaactggtt
catcgtcttgaccgggacacctcaggtgttttgctggtagcgaaaaaacgctcggcgttg
cgttctctgcatgagcaattacgtgaaaaagggatgcaaaaagattacctggcgctggtg
cgcggtcagtggcagtcgcatgtgaagagcgttcaagcaccgttactgaaaaatattctg
caaagcggcgaacgtatcgtgcgtgtgagtcaggaaggcaaaccgtcggaaacacgcttt
aaagtggaagaacgctatgcatttgccaccctggtgcgttgtagcccggtaacagggcgt
actcaccagatccgtgtgcatacacaatatgcgggtcatccgattgcctttgacgatcgc
tacggtgaccgtgaatttgacaggcagctcactgaagcaggcacgggattaaatcgcctg
ttcctgcacgctgcagcgttgaagtttactcatccggggaccggtgaggtgatgcgtatc
gaagctccgatggatgaaggtttgaagcgttgtttgcaaaagctgcgtaacgcgcgctaa
              
                            

Download fasta file
RegulonDB