RegulonDB RegulonDB 10.9: Gene Sequence
tfaE gene sequence


Size: 603        A: 177  T: 138  G: 148  C: 140

Fasta

 

>tfaE E. coli K12. Version NC_000913.3 GI:556503834
atgcataaagcaatattaaatagtgaccttattgcaacaaaggcaggggatgttaccgtt
tataactacgatggtgaaacacgggaatatatttccacttcaaatgaatatcttgccgtt
ggtgtcggcattccggcatgttcctgtttagatgcccctggtacacataaggctggttat
gcaatctgccgttctgcagattttaactcatgggaatatgtgccagaccatcgcggtgaa
acggtctatagcaccaaaactggagaatcaaaagaaatcaaagctccgggtgattaccct
gaaaatacaaccactatcgcccctttatctccatacgataaatgggatggtgagaaatgg
gtgaccgatactgaagcacagcatagcgccgcagtagacgcggcagaagcacagcgccag
tcactgattgatgctgcaatggcttccattagtctgattcaactgaaattgcaggccgga
cgtaaactgacgcaggcagaaacaaccagacttaacgctgtgctggattacattgacgcg
gtgacggcaacagataccagcaccgcgccggatgtcatctggcctgaactgccggaggcg
tag
              
                            

Download fasta file
RegulonDB