RegulonDB RegulonDB 10.9: Gene Sequence
yciB gene sequence


Size: 540        A: 114  T: 175  G: 130  C: 121

Fasta

 

>yciB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcagtttcttgattttttaccgctggttgtctttttcgcgttttacaagatttat
gacatctatgcggctactgcggcgctgatcgtcgccacggcgattgtgcttatctatagc
tgggttcgctttcgtaaggttgagaagatggccctgatcacttttgttctggtggtcgtc
ttcggtggcttgacgctgttcttccacaatgatgagtttattaaatggaaggttactgtc
atttatgctctatttgcgggagccctgttagtcagccaatgggtgatgaaaaagccgcta
attcagcggatgctgggtaaagaactcacgctgccgcaaccggtatggtcgaagctgaat
ctggcctgggctgttttctttatcctttgcggtctggcaaacatctacatcgcattctgg
ctgccgcaaaatatttgggtcaactttaaagtctttggcctgaccgcccttaccttaatc
ttcacattgttaagcggtatctatatctaccgccacatgccgcaggaagataaatcctaa
              
                            

Download fasta file
RegulonDB