RegulonDB RegulonDB 10.9: Gene Sequence
yciC gene sequence


Size: 744        A: 151  T: 226  G: 191  C: 176

Fasta

 

>yciC E. coli K12. Version NC_000913.3 GI:556503834
atgtctatcacggcgcagtccgtataccgtgacaccggaaatttcttccgtaatcaattt
atgaccattctgttggtatcgttgctatgtgcgtttatcacagtggtgttagggcatgtt
ttctcacccagtgatgcacagcttgcgcagctcaatgacggcgtgcccgttagcggcagt
agtgggttgttcgacctggttcagaatatgtcaccggaacagcaacaaattttgctgcag
gcttcagcggcgtccactttttcaggattaatcggtaacgccattctcgccggaggcgta
atattaattatccagctggtgtctgcgggtcagagagtcagtgcgctgcgagctattggt
gccagtgcgccgatattgccaaagttatttattctgatttttctgactacccttttagta
cagattggcatcatgctggtggtcgttccgggaattatcatggccattttactggccctg
gcaccggtgatgttggtacaggacaaaatgggcgtttttgcctcgatgcgtagcagtatg
cggctgacttgggcgaatatgcgtctggtggcacccgcagtactgagctggttgctggca
aaaacactgttgctgctttttgcctcttcttttgccgcattaaccccggaaattggtgcc
gtactggcgaacaccttgagcaacctgatttcagccatattgctcatctatctgttccgc
ctgtatatgttgattcgccaataa
              
                            

Download fasta file
RegulonDB