RegulonDB RegulonDB 10.9: Gene Sequence
ompW gene sequence


Size: 639        A: 152  T: 167  G: 175  C: 145

Fasta

 

>ompW E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagttaacagtggcggctttggcagtaacaactcttctctctggcagtgccttt
gcgcatgaagcaggcgaattttttatgcgtgcaggttctgcaaccgtacgtccaacagaa
ggtgctggtggtacgttaggaagtctgggtggattcagcgtgaccaataacacgcaactg
ggccttacgtttacttatatggcgaccgacaacattggtgtggaattactggcagcgacg
ccgttccgccataaaatcggcacccgggcgaccggcgatattgcaaccgttcatcatctg
ccaccaacactgatggcgcagtggtattttggtgatgccagcagcaaattccgtccttac
gttggggcaggtattaactacaccaccttctttgataatggatttaacgatcatggcaaa
gaggcagggctttccgatctcagtctgaaagattcctggggagctgccgggcaggtgggg
gttgattatctgattaaccgtgactggttggttaacatgtcagtgtggtacatggatatc
gataccaccgccaattataagctgggcggtgcacagcaacacgatagcgtacgcctcgat
ccgtgggtgtttatgttctcagcaggatatcgtttttaa
              
                            

Download fasta file
RegulonDB