RegulonDB RegulonDB 10.9: Gene Sequence
yciE gene sequence


Size: 507        A: 167  T: 134  G: 102  C: 104

Fasta

 

>yciE E. coli K12. Version NC_000913.3 GI:556503834
atgaatcgtattgaacattatcatgactggttacgtgacgcccacgcaatggaaaagcaa
gccgaatctatgcttgaatccatggccagccgtatagataattatcctgaactacgcgct
cgtattgaacaacatcttagtgaaaccaaaaaccagattgttcaactggaaactattctt
gatcgtaatgacatttcacgttcagtcattaaagattccatgagtaaaatggctgcgctt
gggcagtcaatcggtggtatattcccttctgatgaaatagtcaaaggctctattagcgga
tatgtcttcgagcaatttgaaatcgcctgttacacctcactattagcagcagcaaaaaat
gccggtgatacagcttcaattccaaccatcgaagcgattttaaatgaggaaaagcaaatg
gccgactggctgattcagaatattccgcaaacaactgagaaatttttaattcgctctgaa
actgatggcgtagaagcgaagaaataa
              
                            

Download fasta file
RegulonDB