RegulonDB RegulonDB 10.9: Gene Sequence
yciF gene sequence


Size: 501        A: 182  T: 103  G: 117  C: 99

Fasta

 

>yciF E. coli K12. Version NC_000913.3 GI:556503834
atgaatatgaagaccattgaagatgtatttattcacctgctttcagatacctacagcgca
gaaaaacaattaacccgggcactggcaaaactcgcaagagcaacatcaaatgaaaaatta
agtcaggcttttcatgcgcacctcgaggaaactcatggacagattgaacgtattgatcaa
gttgtggagtccgaatcgaacctgaaaattaagcgcatgaaatgtgtggcaatggaaggt
cttattgaagaagctaatgaggtcatcgaaagtaccgagaaaaacgaagtgcgtgatgcc
gcactgattgccgcagcacagaaagtcgagcattatgagattgccagttacgggacatta
gcgacgctggctgaacaattaggttaccgtaaagcagcgaagcttctgaaagaaaccctg
gaagaagaaaaggccaccgacatcaaactgactgatctggccattaataacgtaaataag
aaagccgaaaataaagcctga
              
                            

Download fasta file
RegulonDB