RegulonDB RegulonDB 10.9: Gene Sequence
yciG gene sequence


Size: 180        A: 57  T: 31  G: 54  C: 38

Fasta

 

>yciG E. coli K12. Version NC_000913.3 GI:556503834
atggccgaacatcgtggtggttcaggaaatttcgccgaagaccgtgagaaggcatccgac
gcaggccgtaaaggcggtcagcatagcggcggtaattttaaaaatgatccgcaacgcgca
tctgaagcgggtaaaaaaggcggtcaacaaagcggtggtaataaatcaggcaaatcctga
              
                            

Download fasta file
RegulonDB