RegulonDB RegulonDB 10.9: Gene Sequence
rem gene sequence


Size: 252        A: 68  T: 82  G: 66  C: 36

Fasta

 

>rem E. coli K12. Version NC_000913.3 GI:556503834
atgatgaacatcgaagaactgcgtaaaattttttgtgaagatggcctctatgctgtgtgc
gttgaaaatggaaatcttgttagtcattaccgcattatgtgtttgcgaaagaatggggct
gcgttaattaattttgtggatgctcgggtcacggacggatttatcttgcgcgaaggtgag
tttgtcacttcattacaggcattgaaagagatcggaataaaagctggcttttctgctttt
tcaggagaataa
              
                            

Download fasta file
RegulonDB