RegulonDB RegulonDB 10.9: Gene Sequence
ppsR gene sequence


Size: 834        A: 199  T: 207  G: 210  C: 218

Fasta

 

>ppsR E. coli K12. Version NC_000913.3 GI:556503834
atggataatgctgttgatcgccacgttttttatatttctgatggtacggcaataactgcg
gaggtattaggacacgcagtaatgtcacaatttcccgtcactatcagcagcatcacgctg
ccgtttgtcgaaaatgagagccgtgcacgggcagtgaaggatcagattgacgcaatttat
caccagacaggcgtgcgcccgctggtcttctactccatcgtgttgccggagattcgcgcc
atcatcttgcaaagtgaaggcttttgccaggatatcgttcaggcgctggttgccccgcta
caacaagagatgaaactggatccaacgccgattgctcatcgtacccatggccttaaccct
aataatctcaataaatatgatgcgcgcattgcggcgattgattacaccctcgcccacgat
gacggcatttcgttgcgcaatctggaccaggctcaggtgatcctgctcggtgtttctcgc
tgtggtaaaacccccaccagtctgtatctggcaatgcagtttggtatccgcgcggcaaac
tacccctttattgccgacgatatggataatctggtgctacccgcgtcgctcaaaccgctt
cagcataaattgttcggcctgactatcgacccggaacgtctggcggcgattcgcgaggaa
cgtcgggagaacagtcgctatgcctcgcttcgtcagtgcaggatggaagtcgcggaagtg
gaagccttgtaccgtaaaaatcagatcccgtggattaacagtaccaattattcggtagaa
gagattgccaccaagatcctcgatatcatgggccttagtcgccgaatgtactag
              
                            

Download fasta file
RegulonDB