RegulonDB RegulonDB 10.9: Gene Sequence
nlpC gene sequence


Size: 465        A: 112  T: 122  G: 119  C: 112

Fasta

 

>nlpC E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttctgccttattttgatcacagcactgcttctggccgggtgtagccaccataaa
gcaccgccgccaaatgccagactttctgattcgattaccgttattgccggtttgaacgac
cagctacaaagctggcatggcacgccgtatcgttatggtggcatgacgcggcgcggtgtg
gactgttcgggatttgtggttgtgacgatgcgcgatcgtttcgatttgcagctgccccgt
gaaaccaaacaacaagcctctattggcacgcaaattgataaagacgagttgctgccaggt
gacctggtctttttcaaaacggggtccggacaaaatggtttgcatgtaggtatttacgat
accaacaaccaatttatccacgcctctaccagcaagggagtgatgcgttcctcacttgat
aatgtctattggcagaaaaatttctggcaggcgagacgaatctag
              
                            

Download fasta file
RegulonDB