RegulonDB RegulonDB 10.9: Gene Sequence
ydjA gene sequence


Size: 552        A: 124  T: 119  G: 167  C: 142

Fasta

 

>ydjA E. coli K12. Version NC_000913.3 GI:556503834
atggatgcactcgaactattgatcaatcgccgtagcgcctcccgcttggctgaacccgcg
ccaacgggtgaacaactgcaaaacatcctgcgtgcgggtatgcgtgcgccggaccataag
tccatgcaaccgtggcatttttttgtgattgaaggggaagggcgcgagcgtttcagcgcc
gtactggaacagggggcgattgctgccggtagtgatgacaaagctatcgacaaagcccgt
aatgcgccgttccgcgcaccgctcatcatcacggtggtggcgaaatgcgaagagaatcat
aaagtcccgcgctgggaacaggaaatgtctgccggatgcgcggtcatggcgatgcaaatg
gcagcagttgcccaggggtttggcggcatctggcgcagtggcgcattaactgaaagtccg
gtagtgcgtgaagcattcggttgccgtgagcaggataaaattgtcggttttctctacctc
ggtacgccgcagctgaaagcatctacgtcgattaacgtcccggacccgacgccgtttgta
acttatttctga
              
                            

Download fasta file
RegulonDB