RegulonDB RegulonDB 10.9: Gene Sequence
pncA gene sequence


Size: 642        A: 150  T: 151  G: 184  C: 157

Fasta

 

>pncA E. coli K12. Version NC_000913.3 GI:556503834
atgccccctcgcgccctgttactggtcgatttacaaaatgatttctgtgctggtggcgcg
ctcgccgtgccggaaggtgacagtacggtggatgtcgctaaccgcctgattgactggtgc
cagtcgcgcggtgaagcggttatcgccagtcaggactggcacccggcgaatcacggcagt
tttgccagtcagcacggtgtagagccttatacgccaggccaactcgacggtttgccacaa
accttctggccagatcactgtgtgcagaacagtgaaggcgcacaattacatccgttactg
caccaaaaagcgatcgcagcggtgttccataaaggcgaaaatcctttagttgacagttac
agtgccttttttgataacggccgtcggcagaaaacctctctcgatgactggttacgcgat
catgaaatcgatgaattgatcgttatgggcctggctactgactattgcgtgaagtttacc
gtgctggacgcgttacagttaggttataaggtaaacgtgattaccgatggttgtcgtggc
gtgaatatccagccccaggacagtgcgcacgcgtttatggagatgtcagcagctggggca
acgctatatacgctggcagactgggaagagacacaggggtaa
              
                            

Download fasta file
RegulonDB