RegulonDB RegulonDB 10.9: Gene Sequence
yebB gene sequence


Size: 603        A: 164  T: 173  G: 139  C: 127

Fasta

 

>yebB E. coli K12. Version NC_000913.3 GI:556503834
gtgaatattaattaccctgctgaatatgaaattggagatatcgtctttacatgtataggt
gctgccttatttggtcaaatatcagctgcatcaaattgctggagtaatcacgtcgggatc
attatcggtcataacggtgaagacttcctggttgcagaaagccgggttcccctttcaacc
atcaccacgctatctcgttttattaaacgttcgtctaatcaacgctatgctataaagcga
ttagacgctgggctgacagaacgacaaaaacaacgaattgttgaacaggttccctcccgg
ctacgcaaactttaccacaccggttttaaatacgaatcttcgcgccagttctgttcaaaa
tttgtttttgatatttataaagaagcgctatgtattccggtgggtgaaatagagacgttt
ggagaattgttaaatagcaatccgaatgcaaaactcactttctggaaattctggttcctg
ggttctattccgtgggagcgtaaaaccgtcacgccagccagtttgtggcatcatccgggt
ttggtgttgattcatgcggagggagtggaaacgcctcagccggaactgaccgaggcggta
taa
              
                            

Download fasta file
RegulonDB