RegulonDB RegulonDB 10.9: Gene Sequence
yebC gene sequence


Size: 741        A: 199  T: 155  G: 215  C: 172

Fasta

 

>yebC E. coli K12. Version NC_000913.3 GI:556503834
atggcaggtcatagtaaatgggccaacaccagacatcgtaaagctgcgcaggatgctaag
cgcggtaaaatcttcactaaaatcattcgtgagctggtaaccgcggctaagctgggcggt
ggcgatccggacgctaacccgcgtctgcgtgcggcggtggataaagcactgtctaacaac
atgacccgtgacacactgaaccgcgcaattgcacgtggtgtgggcggtgatgatgatgca
aacatggaaaccatcatctacgaaggttacggtcctggcggcacggcaatcatgattgaa
tgtctgtctgacaaccgcaaccgtaccgttgctgaagtgcgtcatgcatttagcaaatgt
ggcggtaacctcggtactgatggttccgttgcctatctgttcagcaaaaaaggcgtgatc
tccttcgagaaaggcgatgaagacaccatcatggaagcagcactggaagcaggtgctgaa
gacgttgtgacctatgatgacggcgcgattgatgtctacactgcatgggaagaaatgggt
aaagtgcgcgacgctctggaagcggcaggtctgaaagcagacagcgcggaagtttccatg
atcccgtctaccaaagctgatatggatgcagaaaccgcaccgaaactgatgcgtctgatc
gatatgctggaagattgcgacgacgtgcaggaagtttaccataacggtgaaatctctgat
gaggtcgcagcgactctctga
              
                            

Download fasta file
RegulonDB