RegulonDB RegulonDB 10.9: Gene Sequence
nudB gene sequence


Size: 453        A: 105  T: 110  G: 131  C: 107

Fasta

 

>nudB E. coli K12. Version NC_000913.3 GI:556503834
gtgaaggataaagtgtataagcgtcccgtttcgatcttagtggtcatctacgcacaagat
acgaaacgggtgctgatgttgcagcggcgtgacgatcccgatttctggcagtcggtaacc
ggcagcgtggaagagggtgaaaccgcgccgcaagctgccatgcgcgaagtaaaggaagag
gtcaccattgatgttgtcgctgaacaactgaccttaattgactgtcagcgcacggtagag
tttgaaattttttcacatttacgtcatcgctatgcgccgggcgtgacgcgtaatacggaa
tcatggttctgtcttgcgcttccgcacgagcggcagatcgttttcactgaacatctggct
tacaagtggcttgatgcgcctgctgcggcggcgctcactaagtcctggagcaaccggcag
gcgattgaacagtttgtaattaacgctgcctga
              
                            

Download fasta file
RegulonDB