RegulonDB RegulonDB 10.9: Gene Sequence
uvrY gene sequence


Size: 657        A: 178  T: 152  G: 176  C: 151

Fasta

 

>uvrY E. coli K12. Version NC_000913.3 GI:556503834
ttgatcaacgttctacttgttgatgaccacgaactggtgcgcgcagggatacgacgcatt
ctggaagatataaagggtataaaagtcgtcggtgaggcatcgtgcggtgaagacgccgtt
aagtggtgccggacaaatgccgttgacgtggtgctaatggacatgagtatgccgggcatt
ggcggtcttgaggcgacgcgtaaaatcgcgcgttccacagctgatgtcaaaatcatcatg
cttaccgtccatacagaaaaccctttaccagcgaaagtcatgcaggccggtgctgcgggc
tacctcagcaaaggcgcggctccgcaggaagtcgtgagtgcgattcgttctgtctattca
gggcagcgttacattgcttctgacatcgctcaacaaatggcgttaagccagatcgaacca
gaaaaaacagaaagcccatttgccagtttgtctgaacgtgaattgcagattatgctgatg
atcaccaagggccagaaggtcaatgagatctcagaacagctcaatctcagtccgaaaacg
gtgaacagctaccgctatcgtatgttcagtaaactaaacattcatggcgatgttgagctg
actcacctggcaattcgccatggtctgtgtaatgcggagacattatcaagtcagtga
              
                            

Download fasta file
RegulonDB