RegulonDB RegulonDB 10.8: Gene Sequence
yfaA gene sequence


Size: 1689        A: 423  T: 402  G: 448  C: 416

Fasta

 

>yfaA E. coli K12. Version NC_000913.3 GI:556503834
atgagtggtgaaaaaaaggcgaaaggctggcggttctatggtcttgtaggttttggcgca
atagcactgctttccgctggcgtctgggcgttgcaatatgctggcagtgggccagaaaaa
acgttgtcgccgctggtggtgcacaacaatctgcaaatcgatctcaatgagccggacctc
tttctcgacagcgactctctgagccagcttcccaaagatctcctcaccattccgtttctc
cacgatgttctgagcgaagatttcgttttctattatcagaatcatgccgatcgtctgggc
attgaaggcagcattcgtcgtattgtctatgaacacgatctcacgctgaaagataagctc
ttttcgtcactcttagatcagcccgcgcaggcagcgctgtggcacgataaacaaggccat
ctttcacattatatggtgctgatccagcgcagtggtttaagcaaactgctggagccattg
ttgtttgccgctaccagcgacagccagttaagcaaaacggaaatcagtagcatcaagata
aatagtgaaactgttcctgtttatcagttgcgctataacggcaataacgccctgatgttc
gcgacttatcaggacaagatgctggtgttttccagcacggatatgttgtttaaagatgat
cagcaggataccgaagccacggcgatcgcaggtgatttgttgagcggcaaaaaacgctgg
caagcaagctttggcctggaagagcgtactgccgaaaaaacgccagtacgccagcgcatc
gtagtcagcgccaggtggctggggtttggctaccagcggttaatgccttcttttgctggc
gtacgcttcgaaatgggtaacgacggctggcacagttttgtggcgttaaatgatgaatcc
gccagcgtagatgccagtttcgattttacgccggtatggaacagtatgcctgccggagcc
agcttctgtgtggcggtgccgtattcacacggtattgccgaagagatgctttcgcacatc
agccaggaaaacgacaagctgaatggggcgttagacggtgccgcggggctgtgctggtat
gaagactcaaaattgcaaaccccgctgtttgtcggtcagtttgatggcactgccgaacag
gcgcaattgccagggaaactgtttacgcaaaatattggtgcgcacgaaagcaaagcgcca
gaaggtgttttgccggtaagccagactcagcagggcgaagcgcaaatctggcgtcgcgaa
gtgagttcccgatacggccagtatccgaaagcgcaggcggcgcaacccgatcaattaatg
tcggattattttttccgtgtgtcgctggcgatgcaaaacaaaacgctgcttttctccctc
gatgacacgctggttaataacgcgctgcaaacactgaataaaacccgcccggcaatggtg
gatgtaatacccactgatggcatcgttccgctctatatcaatccacaaggaatagcgaaa
ctgctgcgtaacgaaacgttgaccagtctgccgaagaatctcgaaccggttttttataac
gccgcacaaactttattaatgccgaagctggacgctttatctcaacaaccgcgttatgtc
atgaagctggcccagatggaacccggtgccgcctggcagtggctacccataacctggcag
ccgctatga
              
                            

Download fasta file
RegulonDB