RegulonDB RegulonDB 10.10: Gene Sequence
ubiG gene sequence


Size: 723        A: 176  T: 155  G: 225  C: 167

Fasta

 

>ubiG E. coli K12. Version NC_000913.3 GI:556503834
atgaatgccgaaaaatcgccggtaaaccataacgtagaccacgaagagatcgctaaattt
gaagccgtcgcctcccgctggtgggatctggaaggtgagttcaaaccgctgcaccgcatt
aacccgctgcgtctgggctatattgccgagcgtgctggcggtttatttggcaaaaaggtg
ctcgatgtcggttgtggcggcggcattctggccgagagtatggcgcgcgaaggcgcgacg
gtgaccggtctggatatgggctttgagccattgcaggtggcaaaactgcacgcactggaa
agcggcattcaggtggattacgtgcaggaaaccgtggaagagcacgcggcaaaacatgcc
gggcagtatgatgtggtgacctgcatggagatgctggagcacgtccccgatccgcagtca
gtggtcagagcctgtgcgcaactggtgaaaccaggcggcgatgtctttttctcgacactt
aaccgcaacggcaagtcatggctgatggcggtggttggtgcggaatatattttgcgcatg
gtgcccaaaggcacgcatgatgtgaagaagtttattaaaccggcagaattgctgggctgg
gtggatcagaccagtttaaaagagcggcatatcactgggctgcattacaacccgatcact
aatacttttaaactcggccccggcgtggatgtgaactatatgctgcacacgcagaataag
tga
              
                            

Download fasta file
RegulonDB